Journal: International immunology

Article Title: The pre-TCR signal induces transcriptional silencing of the TCRγ locus by reducing the recruitment of STAT5 and Runx to transcriptional enhancers.

doi: 10.1093/intimm/dxr055

Figure Lengend Snippet: Fig. 7. STAT5 and Runx induce transcription of TCRc genes in a DP cell line. (A) DPK cells were transduced with indicated retrovirus, cultured with or without IL-7 for 72 h and analyzed for surface expression of CD4 and CD8 (left panels) and IL-7Ra (right histograms). Histograms show IL- 7Ra expression gated on CD4+CD8+ (DP) cells (left) and CD4CD8+ (8SP) cells (right), respectively. In histograms, thin and bold lines indicate cells with or without IL-7 stimulation, respectively. Shaded areas indicate isotype control. (B and C) Total RNA from indicated DPK cells cultured with or without IL-7 for 72 h was analyzed by PCR for the presence of germline (B) and rearranged Vc-Jc (C) transcripts. Genomic DNA from DPK cells or intraepithelial lymphocytes (IEL) served as controls. The data represent one of four independent experiments with similar results. (D–F) DPK cells were transduced with mock, WT- or CA-STAT5a retrovirus. Cells were cultured and analyzed as described in A–C.

Article Snippet: Briefly, soluble chromatin consisting 200- to 1000-bp fragments was immunoprecipitated with antiacetylated histone H3 antibody (Upstate Biotechnology), rabbit anti-pan-Runx antibody (30), mixture of anti-STAT5A antibody and anti-STAT5B antibody (R&D Systems, Minneapolis, MN, USA) or an equal amount of normal rabbit IgG (Upstate Biotechnology) overnight at 4 C. Purified ChIP and input DNAs were measured by PCR and real-time quantitative PCR.

Techniques: Transduction, Cell Culture, Expressing, Control

Journal:

Article Title: Recovery of a Neurovirulent Human Coronavirus OC43 from an Infectious cDNA Clone †

doi: 10.1128/JVI.80.7.3670-3674.2006

Figure Lengend Snippet: Primers used for the construction of the HCoV-OC43 cDNA clone

Article Snippet: Supplemental material is available at http://jvi.asm.org . table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Primer pairs and location Sequence (5′→3′) Primers for pBAC-OC43-5′-3′ CMV5′ (7716-7736 of pBAC-TGEV-5′-3′) a , d GCGGAATTCGTGCAC TTGACATTGATTATTGACTAG b CMV3′ (8297-8316 of pBAC-TGEV-5′-3′) GCACGCAAATCGCTCACAAT ACGGTTCACTAAACGAGCTC OC43L-5′ (1-41 of the OC43 genome) ATTGTGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATC OC43L-3′ (699-719 of the OC43 genome) d GCGGAATTCGTGCAC CCCAACCCACGAATTGACCTG OC43R-5′ (29064-29083 of the OC43 genome) d GCGCAAGCTT ATCTAAATTTTAAGGATGTC OC43R-3′ (30683-30713 of the OC43 genome) GTGATTCTTCCAATTGGCCATAATTAACTTC HDV5′ (30697-30746 of the OC43 genome and 217-227 of pBAC-TGEV-5′-3′, respectively) CCAATTGGAAGAATCACAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA GGGTCGGCATG BGH3′ (506-525 of pBAC-TGEV-5′-3′) d GCGCAAGCTTG CTCTCCCCAGCATGCCTGC Primers for pBAC-OC43 FL JUB1 (28-47 of the OC43 genome) CCCGCTTCACTGATCTCTTG JUBMlu reverse (6469-6491 of the OC43 genome) TCGTCCGGCGCC TCTGCTCAA C GC G TTAGCAGTTC c JUBMlu forward (6469-6492 of the OC43 genome) GAACTGCTAA C GC G TTGAGCAGAG JUBAslSI reverse (12127-12154 of the OC43 genome) AGGTTGGGCGC CGCTACAGC G CG A TCGCGTTCATAAGCAG JUBAslSI forward (12127-12154 of the OC43 genome) CTGCTTATGAACGCGA T CG C GCTGTAGC JUB105 (18973-18993 of the OC43 genome) TACAAAAGAGTCTTAACAGAC JUB94 (18562-18582 of the OC43 genome) TAGAACTGGTTACTATGGTTG JUBSac2 reverse (24056-24082 of the OC43 genome) GAATTGATTGT C CG C GGTTGTACTACC JUBSac2 forward (24058-24082 of the OC43 genome) TAAGGTGGCGCC TAGTACAACC G CG G ACAATCAATTC JUO2 (30495-30514 of the OC43 genome) GCAGCAAGACATCCATTCTG Open in a separate window a The sequence of pBAC-TGEV-5′-3′ was provided by Luis Enjuanes. b Nucleotides in boldface contain restriction sites and are not included in the primer location. c Underlined nucleotides indicate mutated bases with regard to the genome sequence of the HCoV-OC43 ATCC strain (GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AY585228","term_id":"50844468","term_text":"AY585228"}} AY585228 ). d External primer used for the generation of overlapping PCRs.

Techniques: Sequencing